Comparative Primate Blog Post

For my topic, I will discuss the "Dentition patterns" of these 5 primates. Dentition is the development of their teeth and their arrangement in the primates mouth as well as the number of teeth they have.

Lemurs (Prosimians/Strepsirhini)

a. Lemurs are a tropical rain forests species that are mainly found in Madagascar, off the east coast of Africa. They evolved to cope with the extremely seasonal environment since it is very hot and humid.
b. The dentition pattern of Lemurs is the bottom four front teeth and canine teeth, in total sixth teeth, are faced forward rather then up. They are finely spaced providing themselves a tool for grooming or feeding. Lunars are herbivores and eat mainly trees and plants or anything else the forest has too offer such as sap, seeds, bark, and leaves.
Dentition Formula:
(Incisors)(Canine)(Premolars)(Molars)
2.1.3.3
c. The lemurs teeth are perfectly adapted and finely spaced providing themselves a tool for grooming or feeding or for shearing leaves and crushing seeds since thats mainly whats to be found in the forests. They use their long toothcomb to cut through tree bark or to bring out the flow of tree sap.


Spider Monkey (New World Monkey/Platyrrhini)

a. Spider Monkeys live in the tropical rain forests of Central and South America and as well occur as far North as Mexico. They live mostly in the upper canopy in the high forests and prefer moist evergreen forests and undisturbed primary forests.
b. The dentition pattern of Spider Monkeys is the upper crown of their teeth is very wide and the lingual surface is a bit concave and has a very narrow marginal ridge. The upper Canines are a triangular shape thats slightly narrow. The lower incisor has a narrow, straight crown. They have three premolar teeth instead of two in each toothrow. Their diets consists of mainly 90% fruits and seeds and as well as young leaves, flowers, aerial roots, and sometimes honey.
Dentition Formula:
(Incisors)(Canine)(Premolars)(Molars)
2.1.3.3
c. With have different types of teeth, they are able to eat variety of foods and process food easier. The usage of incisors are for biting, canines for shearing, and molars for chewing food properly for being digestible.

Baboon (Old World Monkey/Cercopithecidae)

a. Baboons are scattered throughout East Africa and Arabia and live in a wide variety of habitats and are extremely adaptable. The only requirements they seems to have is for any habitat that supplies water sources and undisturbed sleeping places such as tall trees or on cliff faces.
b. Baboons dentition patters posses teeth that are designed to each both meat and plants. Their patters consist of important long, sharp canines to seize and protect. Its premolars are enlarged and compressed laterally to form a cutting edge. Their molars have larger flatter surfaces which is suitable for crushing and smashing plants. Baboons are opportunistic eaters and still would eat insects and sometimes prey of fish, birds, rodents, small monkeys and small antelopes.
Dentition Formula:
(Incisors)(Canine)(Premolars)(Molars)
2.1.2.3
c. With such long canine teeth, they are able to protect themselves very well from predators. They sometimes use their smaller front teeth as a comb to remove small bugs or dirt that cling to their hair. Also Baboons teeth are specifically designed to perform the necessary stabbing, ripping, and tearing of their meals


Gibbon (Lesser ape/Hylobatidae

a. Gibbon are apes of southeastern Asia in the tropical rain forests and spend most of their lives in trees. Which makes it very hard for predators to catch them.
b Gibbons dentition is similar to the great apes. Their upper molars are usually very large and their canines are very important when it comes to tearing up their small portions of meals. Their omnivores and their diet consist of mainly fruits, plants, flowers, seeds, tree bark, as well as insects and other small animals.
Dentition Formula:
(Incisors)(Canine)(Premolars)(Molars)
2.1.2.3
c. Gibbons adaptations include the usage of their high cusps on their back teeth to help grind plants and they adapted a gut for folivorous diet.


Chimpanzee (Great ape/Hominidae)

a. Chimpanzees are scattered around the forests of west and central Africa and can habituate themselves to rain forest, woodland, and grasslands.
b. Chimpanzees dentition has six permanent maxillary teeth and an outward jutting jaw. They are usually fruit and plant eaters, but they can also consume insects, eggs, and meat.
Dentition Formula:
(Incisors)(Canine)(Premolars)(Molars)
2.1.2.3
c. Even though the chimpanzees eat mainly fruits, they still use their canines to eat, tear and chew their fruits and plants. Their thinner enamel also helps with tearing through their foods.



After researching and reading of all the primates dentition patterns, it is very interesting noticing how significant the changes the primates have. I feel the teeth are one of the most useful things in the body and each primates dentition structure is adapted perfectly with what that specific primate eats. Such as the long canine teeth in the baboon and gibbon teach structures is perfectly places there for their carnivorous ways. On the other hand the Lemurs and Spider Monkey have a smaller jaw structure which makes the process of eating different kinds of fruits and veggies easier. All these primates are very similar in a lot of ways, and their dentition patters are one of them. There just structured a little different because of the different eating habits that the primates have.

Analogy/Homology Blog Post

                                          Homolgous Trait and Analogous Traits

1) Homologus: Echidna (Mammal) and Platypus (Mammals)

a) The Echidna and the Platypus are both (only) Mammals that are able to lay eggs even though they both look completely different you would not have expected them to be so closely related.

b) The Echidna is very closely related to the anteater which in fact does not lay eggs. They both have the same unique tongues that are very long and able to get into small places since their diet consist of ants and termites. The Platypus is a very strange egg-laying looking mammal that seems to be a mixture of a duck, beaver and an otter. The Platypus has a unique feature and thats producing a venom composed largely of defensin-like proteins around the ankle. To scientist the Platypus plays a big role in the study of evolutionary biology. Even though these two mammals look completely different and you would never assume they were related at all, their homologus trait of being the only mammals that are able to lay eggs shows the common genetic relationship they both have.

c) The common ancestor of these two species is Teinolophos and Steropodon (both extinct monotremes) they evolved from water foraging ancestors which returned to living completely on land.

d)                                                                                                   
                                                                                                                  

2) Analogous Traits: Platypus (mammal) and the duck (bird)

a) Both the Platypus and duck look somewhat similar rather than the Enchidna and the Platypus and they both carry an analogous trait which is they both lay eggs even though ones a bird and the other is a mammal.

b) Their both egg laying creatures with webbed feat and a rubbery snout. They look very similar and they swim about in waters. They both are able to lay eggs, they nostrils are located on top of their beaks and eyes above it. They both have extremely the same features, but are different species.

c) Yes, I do believe the common ancestor of these two traits possess this analogous traits because even though the Platypus were very poorly understood and account of the low numbers of extant species, scientist insist that the duck billed Platypus is an evolutionary link between mammals and birds. 

d)

DNA Molecule Code

TTGATACCACGAGAAATTGAAATGCAACGCAACCTATACACGAATCGTTG

Thomas Malthus influence on Darwin's Theory

1)Thomas Malthus had a positive influence over Darwin’s theory of Natural selection. 

2)Thomas Malthus developed his theory by observing plants and animals produce more young than which could survive. Its reasonable to observe that if population is rising than its hard for the populations resources to keep up. Basically with the rapidness of population growth, their dependence is on how stable the availability of resources is. Malthus argued that even though human kind can produce more foods, he stated that that wouldn't be the case when it comes to needing the recourses into doing so. This in fact would be a harmful tribute to humankind if populations continued to increase rapidly. Malthus also proposed that the only way a population could obtain within its limited resources is by what he called "positive checks" such as disease, war, starvation. These contributed to a raise in death rates. He also proposed "preventative checks" which lowered birth rate as in birth control, late marriage and abstaining from marriage or sexual relations. With all this being said in one of Malthus inspirational essays, "an essay on the principle of population" which also had a huge impact on both Charles Darwin and Alfred Russel Wallace in their own discovery of theories.

http://www.sciencemuseum.org.uk/broughttolife/people/thomasmalthus.aspx

3)>Resourses are limited: Our planet has limit of much it can hold and produce. There will not be enough resources available for all organisms to reproduce as many offspring as they can.

 -I feel that this explains Malthus concept in which he believes that plants and animals produce more young than which could survive. Malthus explanation for the population producing more rapid than what is able to produce more foods and resources shows that Malthus was influential towards Darwins theory.

>All organisms have the potential of reproducing exponentially. Two rabbits are roughly capable of producing approximately an additional 200 rabbits in their lifetime. Imagine if all baby bunnies had 200 more baby bunnies, and so on. This is an example of exponential growth that has the potential of having us up to our eyeballs in rabbits. But we aren't up to our eyeballs in rabbits, are we?

-As Malthus described in his essay the only way population can stay in its limits is with positive checks. To keep the bunnies from over producing, the positive checks maintain the balance. Some forms of maintaing the balance could be by having the bunnies eat something that could harm them, or by a disease spreading through their population. Or other predators that are trying to survive and bunnies end up being their meals which causes a raise in deaths. This also seems to be influential in Darwins key points on the theory of evolution.

4) I feel that Malthus had a great impact on Darwins theory of natural selection because he then found his answer to the question of how new species came to be. He agreed with Malthus idea of population having an increase at a rapid rate then the resources do which lead Darwin into recognition for 'a struggle for existence.' He also saw how selection in nature could be explained such as those individuals with favorable variations would survive and reproduce, but those with unfavorable variations wouldn't. I feel that without the help from Malthus, Darwin’s explanation of evolution theory would not have been the same.

5) The attitude of the church towards Darwin affected his publication of the natural selection because it was thought that if these ideas and theories were to be accepted “the church would crash, the moral fabric of society would be torn apart and civilized man would return to savagery.” With that lingering on it lead to suspicion and a misunderstanding towards evolution that we still endure till today.